About   Help   FAQ
Rnf123em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rnf123em1(IMPC)J
Name: ring finger protein 123; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6164028
Gene: Rnf123  Location: Chr9:107928869-107957183 bp, - strand  Genetic Position: Chr9, 59.07 cM
Alliance: Rnf123em1(IMPC)J page
IMPC: Rnf123 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences AGCCATCAGGATAAGCGTAG, GGCTGAAGCTCCAGACCAGC, GCTTGGAGTGGTGTCAAGAT and GGTGACAGGGACTTACTGTT, which resulted in a 536 bp deletion beginning at Chromosome 9 position 108,071,036 bp and ending after 108,071,571 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001214626 and ENSMUSE00001209882 (exons 4 and 5) and 361 bp of flanking intronic sequence including the splice acceptors and donors. In addition, there is a 47 bp inverted sequence from the deleted region Chr9:108071521-108071567 (TCACCCTTCTCCTTGAACACTGGAGGATGCTTGGCTGAAGCTCCAGA) at the deletion site that is not predicted to alter the results of the exon deletion. This deletion is predicted to cause an early truncation after amino acid 56. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rnf123 Mutation:  60 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory