Rnf123em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rnf123em1(IMPC)J |
| Name: |
ring finger protein 123; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6164028 |
| Gene: |
Rnf123 Location: Chr9:107928869-107957183 bp, - strand Genetic Position: Chr9, 59.07 cM
|
| Alliance: |
Rnf123em1(IMPC)J page
|
| IMPC: |
Rnf123 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences AGCCATCAGGATAAGCGTAG, GGCTGAAGCTCCAGACCAGC, GCTTGGAGTGGTGTCAAGAT and GGTGACAGGGACTTACTGTT, which resulted in a 536 bp deletion beginning at Chromosome 9 position 108,071,036 bp and ending after 108,071,571 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001214626 and ENSMUSE00001209882 (exons 4 and 5) and 361 bp of flanking intronic sequence including the splice acceptors and donors. In addition, there is a 47 bp inverted sequence from the deleted region Chr9:108071521-108071567 (TCACCCTTCTCCTTGAACACTGGAGGATGCTTGGCTGAAGCTCCAGA) at the deletion site that is not predicted to alter the results of the exon deletion. This deletion is predicted to cause an early truncation after amino acid 56.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|