About   Help   FAQ
Srsf5em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Srsf5em1(IMPC)J
Name: serine and arginine-rich splicing factor 5; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6164004
Gene: Srsf5  Location: Chr12:80992308-80997277 bp, + strand  Genetic Position: Chr12, 37.2 cM, cytoband D2
Alliance: Srsf5em1(IMPC)J page
IMPC: Srsf5 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTTATAGTATCTGAGTGTA and TAGGGTCCGTTAGCATTAAA, which resulted in a 694 bp deletion beginning at Chromosome 12 position 80,947,084 bp and ending after 80,947,777 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001244447 and ENSMUSE00001218869 (exons 3 and 4) and 524 bp of flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 42 and early truncation 13 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Srsf5 Mutation:  22 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory