Tmc4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmc4^em1(IMPC)J
• Name: transmembrane channel-like gene family 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6162500
• Gene: Tmc4 Location: Chr7:3668790-3680522 bp, - strand Genetic Position: Chr7, 2.11 cM
• Alliance: Tmc4^em1(IMPC)J page
• IMPC: Tmc4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAACCAGACCTTTTCCCAA and GAGTCAGCGTCAGAAAATGA, which resulted in a 277 bp deletion beginning at Chromosome 7 position 3,675,326 bp and ending after 3,675,602 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001301550 (exon 3) and 131 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 87 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tmc4 Mutation: 26 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)