About   Help   FAQ
Slc39a10em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc39a10em1(IMPC)J
Name: solute carrier family 39 (zinc transporter), member 10; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6162488
Gene: Slc39a10  Location: Chr1:46846704-46932012 bp, - strand  Genetic Position: Chr1, 24.07 cM
Alliance: Slc39a10em1(IMPC)J page
IMPC: Slc39a10 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by microinjecting Cas9 mRNA and 4 guide sequences GTATGAGTACTACCTTAAAG, ATTTTTTGCATAAATTCCTA, TATTTCCTCTGGCCCTGTAG and TCTGATCCTGTATGAATCTT, which resulted in a 521 bp deletion beginning at Chromosome 1 position 46,832,525 bp and ending after 46,833,045 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001325787 (exon 3) and 313 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single bp (A) insertion 164 bp after the exon deletion that will not alter the results of the exon deletion. This deletion is predicted to cause a change of amino acid sequence after residue 338 and early truncation 19 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Slc39a10 Mutation:  49 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory