Ints7^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ints7^em1(IMPC)J
• Name: integrator complex subunit 7; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6161427
• Gene: Ints7 Location: Chr1:191307748-191355800 bp, + strand Genetic Position: Chr1, 96.51 cM
• Alliance: Ints7^em1(IMPC)J page
• IMPC: Ints7 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CAAATACTAACTTATACAGG, TTAAATCTCATATTAAAGTA, TGTCAAATACTAACTTATAC and ATTGTAGGCTTTCTTACAGA, which resulted in a 515 bp deletion beginning at Chromosome 1 position 191,582,302 bp and ending after 191,582,816 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000286639 (exon 2) and 385 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 31 and early truncation 11 amino acids later. (J:188991, J:384794)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ints7 Mutation: 46 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)