Psmd2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Psmd2^em1(IMPC)J
• Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6161408
• Gene: Psmd2 Location: Chr16:20470402-20482164 bp, + strand Genetic Position: Chr16, 12.49 cM
• Alliance: Psmd2^em1(IMPC)J page
• IMPC: Psmd2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences AACTCAAGAGTAATAAACAA and TTAATTGTTCTAATTGTATT, which resulted in a 1640 bp deletion beginning at Chromosome 16 position 20,654,355 bp and ending after 20,655,994 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001269400, ENSMUSE00001242405, ENSMUSE00001235947, ENSMUSE00001282580, ENSMUSE00001296185 (exons 4-8) and 928 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 119 and early truncation 13 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Psmd2 Mutation: 49 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)