About   Help   FAQ
Psmd2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Psmd2em1(IMPC)J
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6161408
Gene: Psmd2  Location: Chr16:20470402-20482164 bp, + strand  Genetic Position: Chr16, 12.49 cM
Alliance: Psmd2em1(IMPC)J page
IMPC: Psmd2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences AACTCAAGAGTAATAAACAA and TTAATTGTTCTAATTGTATT, which resulted in a 1640 bp deletion beginning at Chromosome 16 position 20,654,355 bp and ending after 20,655,994 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001269400, ENSMUSE00001242405, ENSMUSE00001235947, ENSMUSE00001282580, ENSMUSE00001296185 (exons 4-8) and 928 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 119 and early truncation 13 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Psmd2 Mutation:  49 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory