Ankrd52^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ankrd52^em1(IMPC)J
• Name: ankyrin repeat domain 52; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6161380
• Gene: Ankrd52 Location: Chr10:128212993-128229875 bp, + strand Genetic Position: Chr10, 76.54 cM
• Alliance: Ankrd52^em1(IMPC)J page
• IMPC: Ankrd52 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences AGTGCACCTCTCTTTTCAGG, GGGCAAGTTTCACCCTTTGG, CAATGTTGCAAACACAAAGG and GGGTGGAGCTTAGGGCCTTT, which resulted in a 237 bp deletion beginning at Chromosome 10 position 128,380,503 bp and ending after 128,380,739 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001261771 (exon 6) and 149 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 33 bp deletion (TTTGGGGGTGGAGCTTAGGGCCTTTGGGTTTAC) 58 bp after the exon deletion and a 4 bp insertion (GTCC) at the exon deletion site, that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 154 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ankrd52 Mutation: 37 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)