Ints3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ints3^em1(IMPC)J
• Name: integrator complex subunit 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6161377
• Gene: Ints3 Location: Chr3:90298691-90340800 bp, - strand Genetic Position: Chr3, 39.22 cM
• Alliance: Ints3^em1(IMPC)J page
• IMPC: Ints3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GAGGGAAATGAGCTCAGCAG, AATCTCTTCAGTCATCCCGA, GTTCTCCATCTGCCACCATC and TTACATCCTAAAAGAGAGAA, which resulted in a 460 bp deletion beginning at Chromosome 3 position 90,413,231 bp and ending after 90,413,690 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000457114 (exon 6) and 393 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 2 bp deletion (AG) 50 bp before the exon deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 172 and early truncation 3 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ints3 Mutation: 68 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)