Ints3em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Ints3em1(IMPC)J |
Name: |
integrator complex subunit 3; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6161377 |
Gene: |
Ints3 Location: Chr3:90298695-90340929 bp, - strand Genetic Position: Chr3, 39.22 cM
|
Alliance: |
Ints3em1(IMPC)J page
|
IMPC: |
Ints3 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GAGGGAAATGAGCTCAGCAG, AATCTCTTCAGTCATCCCGA, GTTCTCCATCTGCCACCATC and TTACATCCTAAAAGAGAGAA, which resulted in a 460 bp deletion beginning at Chromosome 3 position 90,413,231 bp and ending after 90,413,690 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000457114 (exon 6) and 393 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 2 bp deletion (AG) 50 bp before the exon deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 172 and early truncation 3 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|