About   Help   FAQ
Taok3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Taok3em1(IMPC)J
Name: TAO kinase 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6159644
Gene: Taok3  Location: Chr5:117258194-117413284 bp, + strand  Genetic Position: Chr5, 56.88 cM
Alliance: Taok3em1(IMPC)J page
IMPC: Taok3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTTTGGTGTGGTTAACTTG, AGTGTCCGTGCCTGTACATG, which resulted in a 279 bp deletion followed by a 3 bp (GTG) endogenous retention and an additional 42 bp deletion beginning at Chromosome 5 position 117,203,195 bp and ending after 117,203,518 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001280462 (exon 6) and 275 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 98 and early truncation 29 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Taok3 Mutation:  53 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  6 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/05/2026
MGI 6.24
The Jackson Laboratory