Taok3em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Taok3em1(IMPC)J |
| Name: |
TAO kinase 3; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6159644 |
| Gene: |
Taok3 Location: Chr5:117258194-117413284 bp, + strand Genetic Position: Chr5, 56.88 cM
|
| Alliance: |
Taok3em1(IMPC)J page
|
| IMPC: |
Taok3 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTTTGGTGTGGTTAACTTG, AGTGTCCGTGCCTGTACATG, which resulted in a 279 bp deletion followed by a 3 bp (GTG) endogenous retention and an additional 42 bp deletion beginning at Chromosome 5 position 117,203,195 bp and ending after 117,203,518 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001280462 (exon 6) and 275 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 98 and early truncation 29 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
6 reference(s) |
|