Fbxo21^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fbxo21^em1(IMPC)J
• Name: F-box protein 21; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6159262
• Gene: Fbxo21 Location: Chr5:118114835-118148263 bp, + strand Genetic Position: Chr5, 57.73 cM
• Alliance: Fbxo21^em1(IMPC)J page
• IMPC: Fbxo21 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Fbxo21-113150J-9663M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCCAGGTCTGAATGTGCCG, TTTGTGTACACCTACTCCCG, GCCTCAACCATGAGTTAGCG and CTTCACCAGGATAACTGCAG, which resulted in a 305 bp deletion beginning at Chromosome 5 position 117,979,701 bp and ending after 117,980,005 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000291184 (exon 3) and 210 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single base (G) insertion at the deletion site that will not alter the results of the deletion. This deletion is predicted to cause a change of amino acid sequence after residue 125 and early truncation 23 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Fbxo21 Mutation: 42 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)