About   Help   FAQ
Rnf40em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rnf40em1(IMPC)J
Name: ring finger protein 40; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6158667
Gene: Rnf40  Location: Chr7:127187936-127202777 bp, + strand  Genetic Position: Chr7, 69.61 cM
Alliance: Rnf40em1(IMPC)J page
IMPC: Rnf40 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAACTCAGACACATCACAC, CTGAGAACATAAGCTCCCCA, GGACAAGGATTAGACTGAAA and TGTGGGGCTACCGAAATGCC, which resulted in a 593 bp deletion beginning at Chromosome 7 position 127,589,325 bp and ending after 127,589,917 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000203766 and ENSMUSE00000203748 (exons 3 and 4) and 283 bp of flanking intronic sequence including the splice acceptor and donor. There is a 3 bp (TAC) retention 95 bp (7:127589325-127589419) after the beginning of the 593 bp deletion followed by 495 bp of additional deleted sequence. In addition, 56 bp after the deletion there is a 7 bp insertion (CACATCA) and a 19 bp deletion (GAAATGCCCGGCACTTGGG), that will not alter the results of the deletion. This deletion is predicted to cause a change of amino acid sequence after residue 44 and early truncation 85 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rnf40 Mutation:  47 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory