Palmdem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Palmdem1(IMPC)J |
| Name: |
palmdelphin; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6158662 |
| Gene: |
Palmd Location: Chr3:116711907-116762636 bp, - strand Genetic Position: Chr3, 50.49 cM
|
| Alliance: |
Palmdem1(IMPC)J page
|
| IMPC: |
Palmd gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences ACCGAGCTCCTTCCCTAAAA and AGTCTTATGCATGGCGACAG, which resulted in a 266 bp deletion beginning at Chromosome 3 position 116,947,864 bp and ending after 116,948,129 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000323056 (exon 3) and 141 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 2 bp deletion (GT) 11 bp after the 266 bp deletion that will not alter the results of the 266 bp deletion. The 266 bp deletion is predicted to cause a change of amino acid sequence after residue 42 and early truncation 1 amino acid later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|