About   Help   FAQ
Palmdem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Palmdem1(IMPC)J
Name: palmdelphin; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6158662
Gene: Palmd  Location: Chr3:116711907-116762636 bp, - strand  Genetic Position: Chr3, 50.49 cM
Alliance: Palmdem1(IMPC)J page
IMPC: Palmd gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences ACCGAGCTCCTTCCCTAAAA and AGTCTTATGCATGGCGACAG, which resulted in a 266 bp deletion beginning at Chromosome 3 position 116,947,864 bp and ending after 116,948,129 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000323056 (exon 3) and 141 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 2 bp deletion (GT) 11 bp after the 266 bp deletion that will not alter the results of the 266 bp deletion. The 266 bp deletion is predicted to cause a change of amino acid sequence after residue 42 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Palmd Mutation:  36 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/16/2024
MGI 6.23
The Jackson Laboratory