D5Ertd579e^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: D5Ertd579e^em1(IMPC)J
• Name: DNA segment, Chr 5, ERATO Doi 579, expressed; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6158654
• Gene: D5Ertd579e Location: Chr5:36757829-36853368 bp, - strand Genetic Position: Chr5, 19.18 cM
• Alliance: D5Ertd579e^em1(IMPC)J page
• IMPC: D5Ertd579e gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACCTTGACAAGGACAGAAAA, ATTATTTTATGTCACTACGG, ACACTGAGAAGGACCCTGTA and GAATCCCAGAGTTTAAAAAC, which resulted in a 242 bp deletion beginning at Chromosome 5 position 36,619,631 bp and ending after 36,619,872 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001300199 (exon 4) and 175 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a (CCAAG) 5 bp insertion and a 17 bp deletion (TTTTCTGTCCTTGTCAA) 220 bp after the 242 bp deletion that will not alter the results of the exon deletion. This deletion is predicted to cause a change of amino acid sequence after residue 122 and early truncation 7 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any D5Ertd579e Mutation: 63 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)