About   Help   FAQ
D5Ertd579eem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: D5Ertd579eem1(IMPC)J
Name: DNA segment, Chr 5, ERATO Doi 579, expressed; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6158654
Gene: D5Ertd579e  Location: Chr5:36757829-36853368 bp, - strand  Genetic Position: Chr5, 19.18 cM
Alliance: D5Ertd579eem1(IMPC)J page
IMPC: D5Ertd579e gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACCTTGACAAGGACAGAAAA, ATTATTTTATGTCACTACGG, ACACTGAGAAGGACCCTGTA and GAATCCCAGAGTTTAAAAAC, which resulted in a 242 bp deletion beginning at Chromosome 5 position 36,619,631 bp and ending after 36,619,872 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001300199 (exon 4) and 175 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a (CCAAG) 5 bp insertion and a 17 bp deletion (TTTTCTGTCCTTGTCAA) 220 bp after the 242 bp deletion that will not alter the results of the exon deletion. This deletion is predicted to cause a change of amino acid sequence after residue 122 and early truncation 7 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any D5Ertd579e Mutation:  64 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory