D5Ertd579eem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
D5Ertd579eem1(IMPC)J |
| Name: |
DNA segment, Chr 5, ERATO Doi 579, expressed; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6158654 |
| Gene: |
D5Ertd579e Location: Chr5:36757829-36853368 bp, - strand Genetic Position: Chr5, 19.18 cM
|
| Alliance: |
D5Ertd579eem1(IMPC)J page
|
| IMPC: |
D5Ertd579e gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACCTTGACAAGGACAGAAAA, ATTATTTTATGTCACTACGG, ACACTGAGAAGGACCCTGTA and GAATCCCAGAGTTTAAAAAC, which resulted in a 242 bp deletion beginning at Chromosome 5 position 36,619,631 bp and ending after 36,619,872 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001300199 (exon 4) and 175 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a (CCAAG) 5 bp insertion and a 17 bp deletion (TTTTCTGTCCTTGTCAA) 220 bp after the 242 bp deletion that will not alter the results of the exon deletion. This deletion is predicted to cause a change of amino acid sequence after residue 122 and early truncation 7 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|