About   Help   FAQ
Pus1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pus1em1(IMPC)J
Name: pseudouridine synthase 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6158647
Gene: Pus1  Location: Chr5:110921533-110928523 bp, - strand  Genetic Position: Chr5, 53.7 cM, cytoband F
Alliance: Pus1em1(IMPC)J page
IMPC: Pus1 gene page
Mutation
origin
Strain of Origin:  Not Specified
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences GTACTGTTCTAATAGTATGT and ACTTTAGGACCAGGGTGTGA, which resulted in a 340 bp deletion beginning at Chromosome 5 position 110,775,367 bp and ending after 110,775,706 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001374264 (exon 5) and 237 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 151 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Pus1 Mutation:  27 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory