Cuta^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cuta^em1(IMPC)Mbp
• Name: cutA divalent cation tolerance homolog; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6158509
• Gene: Cuta Location: Chr17:27156946-27158847 bp, - strand Genetic Position: Chr17, 13.6 cM, cytoband B1
• Alliance: Cuta^em1(IMPC)Mbp page
• IMPC: Cuta gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Deletion
• Mutation details: This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences GAGAGGATTTATTGGGGGTT and TCCTTCGTCCGTGCAATGAG that targeted exon(s) ENSMUSE00001462207.2 ENSMUSE00000139480.2 ENSMUSE00000451296.2 ENSMUSE00000610454.2 ENSMUSE00000984096.2 ENSMUSE00001079704.2 ENSMUSE00001231729.2 ENSMUSE00001304641.2 ENSMUSE00001462976.2. This resulted in deletion(s) of 3 bp (location: Chr17:27158543-27158545; GRCm39), 1403 bp (location: Chr17:27156973-27158375; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cuta Mutation: 13 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)