Ces1d^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ces1d^em1(IMPC)Mbp
• Name: carboxylesterase 1D; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6158484
• Gene: Ces1d Location: Chr8:93892700-93924432 bp, - strand Genetic Position: Chr8, 45.05 cM, cytoband C5
• Alliance: Ces1d^em1(IMPC)Mbp page
• IMPC: Ces1d gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from IMPC was generated at UC Davis by injecting CAS9 RNA and the guide sequence CCACCACCAGTCCACCTCCATGG, which resulted in a Indel. (J:237616)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ces1d Mutation: 40 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)