Kcna10^em2(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kcna10^em2(IMPC)Mbp
• Name: potassium voltage-gated channel, shaker-related subfamily, member 10; endonuclease-mediated mutation 2, Mouse Biology Program, UC Davis
• MGI ID: MGI:6158481
• Gene: Kcna10 Location: Chr3:107090459-107103037 bp, + strand Genetic Position: Chr3, 46.64 cM
• Alliance: Kcna10^em2(IMPC)Mbp page
• IMPC: Kcna10 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at UC Davis by injecting CAS9 RNA and 2 guide sequences TTAAGAGTGGCAATGGGTGTGGG, CCTGCTTGCCATGTAAATGCAAG, which resulted in a Exon Deletion. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Kcna10 Mutation: 25 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)