About   Help   FAQ
Gabpaem2(IMPC)Mbp
Endonuclease-mediated Allele Detail
Summary
Symbol: Gabpaem2(IMPC)Mbp
Name: GA repeat binding protein, alpha; endonuclease-mediated mutation 2, Mouse Biology Program, UC Davis
MGI ID: MGI:6158477
Gene: Gabpa  Location: Chr16:84631813-84660667 bp, + strand  Genetic Position: Chr16, 46.92 cM, cytoband C3-4
Alliance: Gabpaem2(IMPC)Mbp page
IMPC: Gabpa gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at UC Davis by injecting CAS9 RNA and the guide sequence CTGATAGAAATTGAGATCGACGG, which resulted in a Indel. (J:237616)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Gabpa Mutation:  67 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory