Abhd11^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Abhd11^em1(IMPC)Mbp
• Name: abhydrolase domain containing 11; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6158461
• Gene: Abhd11 Location: Chr5:135038006-135041029 bp, + strand Genetic Position: Chr5, 74.94 cM
• Alliance: Abhd11^em1(IMPC)Mbp page
• IMPC: Abhd11 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences ACATAACAGGTCTCTTTGTC, ATATGGTTCGAGAGCGGGTG, CCTGGCTTACTCAGTACGAG, and TTCCAAGACTCCCGACTCAG that targeted exon(s) ENSMUSE00000802206.2 ENSMUSE00001743909.1 ENSMUSE00001743910.1 ENSMUSE00001743920.1 ENSMUSE00001751051.2 ENSMUSE00000687088.3 ENSMUSE00000842748.2 ENSMUSE00001283749.2 ENSMUSE00001287190.2 ENSMUSE00001311409.2 ENSMUSE00001364321.2 ENSMUSE00001415908.2 ENSMUSE00001486395.1 ENSMUSE00001743927.1 ENSMUSE00001743942.1 ENSMUSE00001743943.1 ENSMUSE00001743945.1. This resulted in deletion(s) of 33 bp (location: Chr5:135039177-135039209; GRCm39), 46 bp (location: Chr5:135041245-135041290; GRCm39), and 1881 bp (location: Chr5:135039276-135041156; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Abhd11 Mutation: 10 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)