Rnf168em2(IMPC)H
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rnf168em2(IMPC)H |
| Name: |
ring finger protein 168; endonuclease-mediated mutation 2, Harwell |
| MGI ID: |
MGI:6158429 |
| Gene: |
Rnf168 Location: Chr16:32096277-32120252 bp, + strand Genetic Position: Chr16, 22.51 cM, cytoband B2
|
| Alliance: |
Rnf168em2(IMPC)H page
|
| IMPC: |
Rnf168 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences TGGTGGGTTTTTATGGCCCAGGG, AAGCCAACTAAATTACCTAGAGG, CCTCCCTATTAAAAGTATTTGGT, GGTTTTTATGGCCCAGGGCCTGG, which resulted in a Exon Deletion.
(J:237616, J:384794)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Rnf168 Mutation: |
70 strains or lines available
|
|
| Original: |
J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8; |
| All: |
2 reference(s) |
|