About   Help   FAQ
Car10em1Sud
Endonuclease-mediated Allele Detail
Summary
Symbol: Car10em1Sud
Name: carbonic anhydrase 10; endonuclease-mediated mutation 1, Thomas C Sudhof
MGI ID: MGI:6157349
Gene: Car10  Location: Chr11:92988854-93492575 bp, + strand  Genetic Position: Chr11, 58.43 cM, cytoband C
Alliance: Car10em1Sud page
Mutation
origin
Strain of Origin:  (C57BL/6J x SJL/J)F1/J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/Cas9 methodologies were used to delete 61 bp of mouse gene Car10 (including the last 32 bp of exon 2). The guide RNA (gRNA) sequences for the Car10 mutation were: TGAAGGCTGGTGGGCATACAAGG and CCAGGGAAGCTTTGTTCCAGGTA. The exon 2 sequence deletion involves chr11:93185125-93185185. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Car10 Mutation:  19 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory