Car10^em1Sud
Endonuclease-mediated Allele Detail

Summary

• Symbol: Car10^em1Sud
• Name: carbonic anhydrase 10; endonuclease-mediated mutation 1, Thomas C Sudhof
• MGI ID: MGI:6157349
• Gene: Car10 Location: Chr11:92988854-93492575 bp, + strand Genetic Position: Chr11, 58.43 cM, cytoband C
• Alliance: Car10^em1Sud page

Mutation origin

• Strain of Origin: (C57BL/6J x SJL/J)F1/J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 methodologies were used to delete 61 bp of mouse gene Car10 (including the last 32 bp of exon 2). The guide RNA (gRNA) sequences for the Car10 mutation were: TGAAGGCTGGTGGGCATACAAGG and CCAGGGAAGCTTTGTTCCAGGTA. The exon 2 sequence deletion involves chr11:93185125-93185185. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Car10 Mutation: 16 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)