Car11^em1Sud
Endonuclease-mediated Allele Detail

Summary

• Symbol: Car11^em1Sud
• Name: carbonic anhydrase 11; endonuclease-mediated mutation 1, Thomas C Sudhof
• MGI ID: MGI:6157348
• Gene: Car11 Location: Chr7:45349267-45354106 bp, + strand Genetic Position: Chr7, 29.44 cM, cytoband B2
• Alliance: Car11^em1Sud page

Mutation origin

• Strain of Origin: (C57BL/6J x SJL/J)F1/J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 methodologies were used to delete 40 bp from exon 2 of the mouse Car11 gene. Two sets of gRNAs were used to ensure the production of a Car11 mutation: exon1 - CCTGAGCGCCCCTCAAGCGCTGG and CACTGGGAGCGGCAGGTAAG, and exon 2 - GCTCTCTTCCCAGCTCACATCGG and CCGAGGACTGGTGGAGCTACAAG. A 40 bp deletion in exon 2 was produced - chr7:45700427-45700466. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Car11 Mutation: 15 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)