About   Help   FAQ
Prss56em2(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Prss56em2(IMPC)J
Name: serine protease 56; endonuclease-mediated mutation 2, Jackson
MGI ID: MGI:6157340
Gene: Prss56  Location: Chr1:87111035-87116127 bp, + strand  Genetic Position: Chr1, 44.07 cM, cytoband C5
Alliance: Prss56em2(IMPC)J page
IMPC: Prss56 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTAGGTTCCATCGTCCTTG, TTTGAAGGTCCAAGTGGAAG, GCAGGGCCACCCAATCCGAT and GTGTGGCTGTTGTGACCCAA, which resulted in a 845 bp deletion beginning at Chromosome 1 position 87,184,358 bp and ending after 87,185,202 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000985401 and ENSMUSE00001040282 (exons 3 and 4) and 601 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 71 and early truncation 9 amino acids later. qRT-PCR of cDNA from whole eyes at two months of age showed a significant upregulation of Prss56 mRNA in homozygotes of this null allele. (J:188991, J:364267)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Prss56 Mutation:  23 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory