Prss56em2(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Prss56em2(IMPC)J |
| Name: |
serine protease 56; endonuclease-mediated mutation 2, Jackson |
| MGI ID: |
MGI:6157340 |
| Gene: |
Prss56 Location: Chr1:87111035-87116127 bp, + strand Genetic Position: Chr1, 44.07 cM, cytoband C5
|
| Alliance: |
Prss56em2(IMPC)J page
|
| IMPC: |
Prss56 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTAGGTTCCATCGTCCTTG, TTTGAAGGTCCAAGTGGAAG, GCAGGGCCACCCAATCCGAT and GTGTGGCTGTTGTGACCCAA, which resulted in a 845 bp deletion beginning at Chromosome 1 position 87,184,358 bp and ending after 87,185,202 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000985401 and ENSMUSE00001040282 (exons 3 and 4) and 601 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 71 and early truncation 9 amino acids later. qRT-PCR of cDNA from whole eyes at two months of age showed a significant upregulation of Prss56 mRNA in homozygotes of this null allele.
(J:188991, J:364267)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|