Sspo^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sspo^em2(IMPC)Tcp
• Name: SCO-spondin; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6157334
• Gene: Sspo Location: Chr6:48425163-48478184 bp, + strand Genetic Position: Chr6, 23.42 cM
• Alliance: Sspo^em2(IMPC)Tcp page
• IMPC: Sspo gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Toronto Centre for Phenogenomics by injecting CAS9 Protein and 4 guide sequences GCATGGCCAAACATTTACCCAGG, TTGCGTGAACTCCCTTCTCCAGG, GCTATGGCAGGGATCCGTGGTGG, CCCTAACGCCTACATAGGTTAGA, which resulted in a Exon Deletion. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Sspo Mutation: 224 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 1 reference(s)