Mcidas^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mcidas^em2(IMPC)Tcp
• Name: multiciliate differentiation and DNA synthesis associated cell cycle protein; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6157333
• Gene: Mcidas Location: Chr13:113130379-113136928 bp, + strand Genetic Position: Chr13, 63.93 cM
• Alliance: Mcidas^em2(IMPC)Tcp page
• IMPC: Mcidas gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0506 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs having spacer sequences of CCATTCGAGAGGTAAGGATG and ACAGTAGGCTTGCCTTGGGC targeting the 5' side and GGGACAGACGTTAAGTAAAA and TTGCTTCAGGTTAGCTCAGC targeting the 3' side of a critical region. This resulted in a 699-bp deletion of Chr13 from 112996485 to 112997183 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mcidas Mutation: 17 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)