About   Help   FAQ
Otcem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Otcem1(IMPC)Tcp
Name: ornithine transcarbamylase; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156601
Gene: Otc  Location: ChrX:10118584-10187275 bp, + strand  Genetic Position: ChrX, 4.66 cM, cytoband A1
Alliance: Otcem1(IMPC)Tcp page
IMPC: Otc gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR922 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AAGAGACATGCTGCACTATG and AATGCTGTGGGGTAGTCCAT targeting the 5' side and AAGCAATTACCTTGCCTGTG targeting the 3' side of a critical region. This resulted in a 258-bp del ChrX:10264681 to 10264938 and 5-bp indel ChrX:10264981 to 10264985_delCCTTT_ins AA resulting in a frameshift mutation in all annotated full length protein-coding transcripts (GRCm38). (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Otc Mutation:  22 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory