About   Help   FAQ
Glrbem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Glrbem1(IMPC)Tcp
Name: glycine receptor, beta subunit; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156599
Gene: Glrb  Location: Chr3:80750906-80820967 bp, - strand  Genetic Position: Chr3, 35.71 cM, cytoband E3-F1
Alliance: Glrbem1(IMPC)Tcp page
IMPC: Glrb gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0720 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TCTACTAGGAAAAGTCTTGG and CTCGGGTGACTGCTGACTAA targeting the 5' side and ATATAGGTATGAAGACTGGA and TTAGGCTCTGAACATTGATG targeting the 3' side resulting in a 143-bp deletion of Chr3 from 80879590 to 80879732 and a 1-bp deletion Chr3:80879862 (GRCm38). (J:237616, J:384794)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Glrb Mutation:  35 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/19/2026
MGI 6.24
The Jackson Laboratory