Glrb^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Glrb^em1(IMPC)Tcp
• Name: glycine receptor, beta subunit; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156599
• Gene: Glrb Location: Chr3:80750906-80820967 bp, - strand Genetic Position: Chr3, 35.71 cM, cytoband E3-F1
• Alliance: Glrb^em1(IMPC)Tcp page
• IMPC: Glrb gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0720 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TCTACTAGGAAAAGTCTTGG and CTCGGGTGACTGCTGACTAA targeting the 5' side and ATATAGGTATGAAGACTGGA and TTAGGCTCTGAACATTGATG targeting the 3' side resulting in a 143-bp deletion of Chr3 from 80879590 to 80879732 and a 1-bp deletion Chr3:80879862 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Glrb Mutation: 34 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)