About   Help   FAQ
Mrgprx1em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Mrgprx1em1(IMPC)Tcp
Name: MAS-related GPR, member X1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156593
Gene: Mrgprx1  Location: Chr7:47670719-47677345 bp, - strand  Genetic Position: Chr7, 31.09 cM
Alliance: Mrgprx1em1(IMPC)Tcp page
IMPC: Mrgprx1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0434 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of ACTACCCTGGTTGGACTGGC and GCAATCATCCCCTATATCTC targeting the 5' side and CCCTCTTAAGAACTCTTTTC and ATTGACAGTGCCAAGAAAGT targeting the 3' side of exon ENSMUSE00000531437 (exon 2) resulting in a 772-bp deletion of Chr7 from 48020898 to 48021669 (GRCm38). (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Mrgprx1 Mutation:  17 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory