About   Help   FAQ
Zfp629em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp629em1(IMPC)Tcp
Name: zinc finger protein 629; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156578
Gene: Zfp629  Location: Chr7:127206203-127214969 bp, - strand  Genetic Position: Chr7, 69.62 cM
Alliance: Zfp629em1(IMPC)Tcp page
IMPC: Zfp629 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR1036 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CATAGGGGTCTGGTGATCTA and GAGGGTTCCCCACTGCCAAT targeting the 5' side and CGTGTCAGGACATCCACCAC and GCGGAACTTGCTCATGGAAC targeting the 3' side of a critical region. This resulted in a 3716-bp deletion from Chr7:127608671 to 127612386; (predicted effect on protein p.P84X.) (GRCm38). (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp629 Mutation:  36 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory