About   Help   FAQ
Zc3h12bem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Zc3h12bem1(IMPC)Tcp
Name: zinc finger CCCH-type containing 12B; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156569
Gene: Zc3h12b  Location: ChrX:94755284-94976243 bp, + strand  Genetic Position: ChrX, 42.14 cM
Alliance: Zc3h12bem1(IMPC)Tcp page
IMPC: Zc3h12b gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0676 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and three guide RNAs with spacer sequences of AGCAAGTTGTATTCCCCTGC and CGCCCCGATGCACCAATTAC targeting the 5' side and CTCGGACCATGGCGTCCAAG targeting the 3' side of exons ENSMUSE00000842756 and ENSMUSE00001286785 resulting in a 2915-bp deletion of ChrX from 95922379 to 95925293. (GRCm38). (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zc3h12b Mutation:  9 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory