Erlin1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Erlin1^em1(IMPC)Tcp
• Name: ER lipid raft associated 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156564
• Gene: Erlin1 Location: Chr19:44023383-44058224 bp, - strand Genetic Position: Chr19, 36.7 cM
• Alliance: Erlin1^em1(IMPC)Tcp page
• IMPC: Erlin1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0991 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CATCCGTTTGTAGTGTTGTC targeting the 5' side and GTGATTCTATACTTATAACC targeting the 3' side of a critical exon. This resulted in a 1256-bp del Chr19: 44061802 to 44063066 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

11 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Erlin1 Mutation: 27 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)