Tmem11^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem11^em1(IMPC)Tcp
• Name: transmembrane protein 11; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156551
• Gene: Tmem11 Location: Chr11:60755278-60769864 bp, - strand Genetic Position: Chr11, 37.9 cM
• Alliance: Tmem11^em1(IMPC)Tcp page
• IMPC: Tmem11 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from project TCPR0855 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGTGCACGAAATCTACAGTG, TAATCCAGGGGCAGTGCCAA and CCGAACCAGCACCACTGGTG. This resulted in a 16-bp del Chr11:60865301 to 60865316_TGCACGAAATCTACAG; c.del89_104TGCACGAAATCTACAG; p.H31G*fs23 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tmem11 Mutation: 23 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)