Trim16^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trim16^em1(IMPC)Tcp
• Name: tripartite motif-containing 16; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156546
• Gene: Trim16 Location: Chr11:62711034-62733774 bp, + strand Genetic Position: Chr11, 38.75 cM
• Alliance: Trim16^em1(IMPC)Tcp page
• IMPC: Trim16 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1018 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GTCATGACCCCGCAGAGGTC targeting the 5' side and CCAGCTAACCGAACCCGCAA targeting the 3' side of a critical region. This resulted in a 160-bp deletion Chr11:62820676 to 62820835; (predicted effect on protein p.V58Pfs*71) (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Trim16 Mutation: 28 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)