About   Help   FAQ
Phipem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Phipem1(IMPC)Tcp
Name: pleckstrin homology domain interacting protein; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156509
Gene: Phip  Location: Chr9:82748212-82857569 bp, - strand  Genetic Position: Chr9, 45.18 cM, cytoband E3.1
Alliance: Phipem1(IMPC)Tcp page
IMPC: Phip gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0832 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TACCACATTATCTTCACAAC and GGATGAAATACTTTCAGGCT targeting the 5' side and ACTATGTTGTGATGTCCTCT and AAGTTACATGTTGAGTTAAT targeting the 3' side of a critical region. This resulted in a 3,149-bp deletion of Chr9 from 82959244 to 82962392 (GRCm38). (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Phip Mutation:  114 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/12/2026
MGI 6.24
The Jackson Laboratory