Snd1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Snd1^em1(IMPC)Tcp
• Name: staphylococcal nuclease and tudor domain containing 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156505
• Gene: Snd1 Location: Chr6:28480332-28935161 bp, + strand Genetic Position: Chr6, 11.99 cM
• Alliance: Snd1^em1(IMPC)Tcp page
• IMPC: Snd1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0864 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GCAGTTGGATTAAGTAGCAC and TCTTTGGTCTAGCGAGATTG targeting the 5' side and TCCTAGAGCTATGGACATGG and GTGCATACCTCTAGCAGCCC targeting the 3' side of a critical region. This resulted in a 12-bp deletion Chr6:28519921 to 28519932; 325-bp deletion Chr6:28520030 to 28520354; 11- bp deletion Chr6:28520400 to 28520410 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

7 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Snd1 Mutation: 95 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)