Mrpl12^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mrpl12^em1(IMPC)Tcp
• Name: mitochondrial ribosomal protein L12; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156503
• Gene: Mrpl12 Location: Chr11:120375463-120379580 bp, + strand Genetic Position: Chr11, 84.18 cM, cytoband E2
• Alliance: Mrpl12^em1(IMPC)Tcp page
• IMPC: Mrpl12 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1019 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGTATTGCAGACATAGTCGT targeting the 5' side and ACTGCCCGACTCAATAACTT targeting the 3' side of a critical exon. This resulted in a 742-bp del Chr11:120485061 to 120485802_insATAG. (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mrpl12 Mutation: 15 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)