Ccdc88b^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccdc88b^em1(IMPC)Tcp
• Name: coiled-coil domain containing 88B; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156502
• Gene: Ccdc88b Location: Chr19:6821991-6835579 bp, - strand Genetic Position: Chr19, 5.08 cM
• Alliance: Ccdc88b^em1(IMPC)Tcp page
• IMPC: Ccdc88b gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics using Cas9 and guides with spacer sequences AGCGCCGCAGTTCTTCCTGC, ATGCAGTTACGGAGCCTGAC, GCCACCAGCTCTCCGGATTC, and GCGCGCAGAGCTCTACCGCG that targeted exon(s) ENSMUSE00000695600.2 ENSMUSE00000695602.2 ENSMUSE00000695603.2 ENSMUSE00000695604.2. This resulted in deletion(s) of 759 bp (location: Chr19:6832788-6833546; GRCm39), 759 bp (location: Chr19:6832788-6833546; GRCm39), and 759 bp (location: Chr19:6832788-6833546; GRCm39) and insertion of 1 bp (location: chr19:6832787; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ccdc88b Mutation: 71 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)