About   Help   FAQ
Hyls1em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Hyls1em1(IMPC)Tcp
Name: HYLS1, centriolar and ciliogenesis associated; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156495
Gene: Hyls1  Location: Chr9:35472117-35481365 bp, - strand  Genetic Position: Chr9, 20.32 cM
Alliance: Hyls1em1(IMPC)Tcp page
IMPC: Hyls1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0683 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and three guide RNAs with spacer sequences of GCAGCTAACATTCGTTCTTC and CTTTACTGTAGGGATCATAC targeting the 5' side and ACAACGCACACCCCACCGAA targeting the 3' side of exon ENSMUSE00000701722 resulting in a 685-bp deletion of Chr9 from 35561247 to 35561931 (gRNA_U3 to gRNA_D). This mutation is predicted to cause a frameshift with the amino acid changes after residue 63 and early truncation 38 amino acids later (c.188_872del, p.D63Gfs*40). (GRCm38). (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Hyls1 Mutation:  26 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory