Cep55^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cep55^em1(IMPC)Tcp
• Name: centrosomal protein 55; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156491
• Gene: Cep55 Location: Chr19:38043459-38062871 bp, + strand Genetic Position: Chr19, 32.69 cM, cytoband C3
• Alliance: Cep55^em1(IMPC)Tcp page
• IMPC: Cep55 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele, from project TCPR0420, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences ATAATTCCGTCTCACCTATG, ATTCCCTCCAGAGCTGACCT, CTAAATAGATGGATAAGCTC and CGCATGGCGGCCTCGCAGAA. This resulted in a 601-bp deletion in Chr19 from 38069489 to 38070089 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cep55 Mutation: 71 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)