Dusp16^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dusp16^em1(IMPC)Tcp
• Name: dual specificity phosphatase 16; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156484
• Gene: Dusp16 Location: Chr6:134692431-134769588 bp, - strand Genetic Position: Chr6, 65.77 cM
• Alliance: Dusp16^em1(IMPC)Tcp page
• IMPC: Dusp16 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0801 was generated at The Centre for Phenogenomics by electroporation Cas9 ribonucleoprotein complexes with four guide RNAs with spacer sequences of GCTTGTATGCTACTTTTCAA and CTGTTTGAAGACCCCTTGGC targeting the 5' side and ACAGCTTTCGATTGATAGAA and GTGGACTTTCACACCTGACT targeting the 3' side of exon ENSMUSE00001282667 (exon 3). This resulted in a 1003-bp deletion of Chr6 from 134758320 to 134759322 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

7 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dusp16 Mutation: 64 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)