Vps13b^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Vps13b^em1(IMPC)Tcp
• Name: vacuolar protein sorting 13B; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156483
• Gene: Vps13b Location: Chr15:35371306-35931375 bp, + strand Genetic Position: Chr15, 14.46 cM, cytoband B3.3
• Alliance: Vps13b^em1(IMPC)Tcp page
• IMPC: Vps13b gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0923 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CATGGATAATCTGTAACAGC and TGACAGTGCATTGCTATTTA targeting the 5' side and TATGGATTACCTGTATACAG and TGTAACAGTGCAGCTTGCCA targeting the 3' side of a critical exon. This resulted in a 2,348-bp deletion Chr15:35445401 to 35447748 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

10 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Vps13b Mutation: 216 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)