H2bc4^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: H2bc4^em1(IMPC)Tcp
• Name: H2B clustered histone 4; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156478
• Gene: H2bc4 Location: Chr13:23868182-23876805 bp, + strand Genetic Position: Chr13, 9.87 cM, cytoband A2-A3
• Alliance: H2bc4^em1(IMPC)Tcp page
• IMPC: H2bc4 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics using Cas9 and guides with spacer sequences GCTACGGAGGCTTACTTGGC and TTCGCAGGCTCAGGCATCTT that targeted exon(s) ENSMUSE00000254905.5. This resulted in deletion(s) of 395 bp (location: Chr13:23868215-23868609; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any H2bc4 Mutation: 8 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)