About   Help   FAQ
Cox6b1em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Cox6b1em1(IMPC)Tcp
Name: cytochrome c oxidase, subunit 6B1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156449
Gene: Cox6b1  Location: Chr7:30316396-30325539 bp, - strand  Genetic Position: Chr7, 18.84 cM, cytoband A3
Alliance: Cox6b1em1(IMPC)Tcp page
IMPC: Cox6b1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0671 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of GAGCTATATACGCCTGACCT and GTGCTTAGTCGGGGTTGATT targeting the 5' side and GACCACCCAAGGGTCCCGTC and TCACCTCCAAGGGTCAAGCG targeting the 3' side of exon ENSMUSE00000516175. This resulted in a 283-bp deletion of Chr7 from 30623398 to 30623660 and an indel at Chr7:30623292_insC (GRCm38). (J:237616, J:384794)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 5 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cox6b1 Mutation:  12 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/26/2026
MGI 6.24
The Jackson Laboratory