About   Help   FAQ
Cct5em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Cct5em1(IMPC)Tcp
Name: chaperonin containing TCP1 subunit 5; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156448
Gene: Cct5  Location: Chr15:31590946-31601950 bp, - strand  Genetic Position: Chr15, 13.02 cM, cytoband B3.2
Alliance: Cct5em1(IMPC)Tcp page
IMPC: Cct5 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0902 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GACCACAGTCAAGGTCCAAC and AATAGGGCTGGATGTAATCC targeting the 5' side and GGCCACAGTACACTACTGAT and AGGTGATCCAATAACCTAAA targeting the 3' side of a critical exon(s). This resulted in a 395-bp deletion of Chr15 from 31595629 to 31596023 and and indel at Chr15:31595496_insTTG (GRCm38). (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cct5 Mutation:  18 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/02/2024
MGI 6.13
The Jackson Laboratory