About   Help   FAQ
Ilrunem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Ilrunem1(IMPC)Tcp
Name: inflammation and lipid regulator with UBA-like and NBR1-like domains; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156447
Gene: Ilrun  Location: Chr17:27970206-28039516 bp, - strand  Genetic Position: Chr17, 14.59 cM
Alliance: Ilrunem1(IMPC)Tcp page
IMPC: Ilrun gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0781 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CGTCACTACTGAGAAACTAC and CCTAAGAAAGGATTTCCCTC targeting the 5' side and ATTCTGGTAAGTGTATAACG and GACTCAGTCACACCAGGTGG targeting the 3' side of exon ENSMUSE00000449145. This resulted in a 314-bp deletion of Chr17 from 27793890 to 27794203 (GRCm38). (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ilrun Mutation:  89 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory