About   Help   FAQ
Hsd17b4em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Hsd17b4em1(IMPC)Tcp
Name: hydroxysteroid (17-beta) dehydrogenase 4; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156445
Gene: Hsd17b4  Location: Chr18:50261268-50329336 bp, + strand  Genetic Position: Chr18, 27.24 cM
Alliance: Hsd17b4em1(IMPC)Tcp page
IMPC: Hsd17b4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from project TCPR0513 was generated at The Centre for Phenogenomics by injecting Cas9 endonuclease and a guide RNA with the spacer sequence GAAAGAGGAGCATTAGTCAT [and a single-strand oligonucleotide encoding the changes c.105_112delAGTCATT to inactivate the PAM sequence and prevent re-cutting of the repaired allele in ENSMUSE00001289515]. Subsequent NHEJ-mediated repair introduced an indel comprised of a 7-bp deletion of Chr18 from 50130173 to 50130179 (GRCm38) (p.V36*). (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 12 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Hsd17b4 Mutation:  51 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory