About   Help   FAQ
Iars2em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Iars2em1(IMPC)Tcp
Name: isoleucine-tRNA synthetase 2, mitochondrial; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156430
Gene: Iars2  Location: Chr1:185018839-185061615 bp, - strand  Genetic Position: Chr1, 89.48 cM
Alliance: Iars2em1(IMPC)Tcp page
IMPC: Iars2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0561 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of AATTACCAGTGTGTTTTGGG and CATAGACCCTTATCAATACC targeting the 5' side and TTAAACCTTCCTGTCAAACC and AAAAGTCCGGGATTATATGG targeting the 3' side of exon ENSMUSE00001307419 and ENSMUSE00001291581. This allele has two deletion junctions. The first is simply within gRNA_U5 and is a 9-bp deletion Chr1:185328265 to 185328257 in the intron immediately preceding the critical region. The second deletion encompasses the critical region from gRNA_U3 to gRNA_D3 and is a 2,481-bp Chr1:185325328 to 185327808_insGAGT. (GRCm38). (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Iars2 Mutation:  48 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory