Iars2em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
Symbol: |
Iars2em1(IMPC)Tcp |
Name: |
isoleucine-tRNA synthetase 2, mitochondrial; endonuclease-mediated mutation 1, The Centre for Phenogenomics |
MGI ID: |
MGI:6156430 |
Gene: |
Iars2 Location: Chr1:185018839-185061615 bp, - strand Genetic Position: Chr1, 89.48 cM
|
Alliance: |
Iars2em1(IMPC)Tcp page
|
IMPC: |
Iars2 gene page |
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project TCPR0561 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of AATTACCAGTGTGTTTTGGG and CATAGACCCTTATCAATACC targeting the 5' side and TTAAACCTTCCTGTCAAACC and AAAAGTCCGGGATTATATGG targeting the 3' side of exon ENSMUSE00001307419 and ENSMUSE00001291581. This allele has two deletion junctions. The first is simply within gRNA_U5 and is a 9-bp deletion Chr1:185328265 to 185328257 in the intron immediately preceding the critical region. The second deletion encompasses the critical region from gRNA_U3 to gRNA_D3 and is a 2,481-bp Chr1:185325328 to 185327808_insGAGT. (GRCm38).
(J:237616)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8; |
All: |
2 reference(s) |
|