Arid1b^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Arid1b^em1(IMPC)Tcp
• Name: AT-rich interaction domain 1B; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156423
• Gene: Arid1b Location: Chr17:5044607-5397931 bp, + strand Genetic Position: Chr17, 2.83 cM
• Alliance: Arid1b^em1(IMPC)Tcp page
• IMPC: Arid1b gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0317 was generated at The Centre for Phenogenomics by injecting Cas9 nickase (D10A) mRNA and single guide RNAs with spacer sequences of CTGCTTAGCAAGTTACCACT and GCCTGATACAGCACTTACAT targeting the 5' side and ACACTAAAGGGGTTGCTTTC and CTTGTAATCCCCCTGTAGTA targeting the 3' side of exon 5 (OTTMUSE00000314956) resulting in deletion of Chr17 from 5242523 to 5243410 with insertion of TT (GRCm38). (J:237616)

Expression

In Mice Carrying this Mutation:	2 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation:	3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Arid1b Mutation: 110 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 5 reference(s)