Kcnj11^em2H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kcnj11^em2H
• Name: potassium inwardly rectifying channel, subfamily J, member 11; endonuclease-mediated mutation 2, Harwell
• MGI ID: MGI:6156349
• Gene: Kcnj11 Location: Chr7:45746545-45750215 bp, - strand Genetic Position: Chr7, 29.66 cM
• Alliance: Kcnj11^em2H page
• IMPC: Kcnj11 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Single point mutation
• Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA, the guide sequence TACGGTACCTGGGCTCTGCAGGG, and a donor oligo, which resulted in a Point Mutation allele. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Kcnj11 Mutation: 33 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 1 reference(s)