Saxo6^{em1(IMPC)Kmpc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Saxo6^{em1(IMPC)Kmpc}
• Name: stabilizer of axonemal microtubules 6; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center
• MGI ID: MGI:6156327
• Gene: Saxo6 Location: Chr10:117977716-118004902 bp, + strand Genetic Position: Chr10, 66.65 cM, cytoband C1-C3
• Alliance: Saxo6^{em1(IMPC)Kmpc} page
• IMPC: Saxo6 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intergenic deletion
• Mutation details: This allele was generated at Korea Mouse Phenotype Consortium using Cas9 and a guide with spacer sequence GAACGGAACCGTCAGAAAGA that targeted exon(s) ENSMUSE00000232465.4 ENSMUSE00001406124.2. This resulted in deletion(s) of 4 bp (location: Chr10:117982593-117982596; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Saxo6 Mutation: 28 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)